crispr cas9 sgrna  (Addgene inc)

Journal: bioRxiv

Article Title: Orai1 is required for Ca 2+ -dependent plasma membrane repair and mechanoadaptation

doi: 10.64898/2026.05.13.724989

Figure Lengend Snippet: A. Western blot confirmation of loss of Orai1 expression upon CRISPR/Cas9-mediated KO in MDA-MB-231 and Hs578T cells; shown are pools of three clones maintained individually. B-C. Impairment of SOCE upon Orai1 KO in TNBC cells. SOCE was measured using thapsigargin-induced ER Ca 2+ depletion. Typical profiles are shown on left and quantification of fold-change in peak fluorescence intensity from 3 independent experiments is shown on right. Welch’s t test, ***p<0.001. D-E. Orai1-KO impairs the repair of mechanically induced plasma membrane injury. WT vs. Orai1-KO cells were subjected to mechanical injury to plasma membrane and repair assay was performed as in . Representative confocal images are shown in D and quantified data are shown in E. Scale bar, 200 µm. Data represents mean +/- SEM of three experiments, two-way ANOVA, **,p<0.01. F-G. Orai1-KO impairs the repair of SLO-induced membrane injury. Plasma membrane damage using SLO and the repair assay on MDA-MB-231 ( F ) and Hs578T ( G ) cell lines were as in . Representative confocal images are shown on left. Quantification of PI-stained cells from 3 independent experiments is shown on right. Welch’s t test, ***p<0.001. H-J. Orai1 inhibitors impair plasma membrane repair. Panel H shows Thapsigargin (TG)-induced SOCE measurements (initial peak, Ca 2+ store release in the absence of extracellular Ca 2+ ; second peak, SOCE in the presence of extracellular Ca 2+ ) performed on the indicated cell lines cultured with or without CM4620 (10 μM, 4 hours pretreatment). Note significant SOCE inhibition by CM4620 in WT cells but not in Orai1-KO cells, supporting Orai1-selelctive effect of CM4620. Data represents mean +/- SEM of three experiments, Welch’s t test, ***p<0.001. The I panel shows the impairment of mechanically induced plasma membrane repair by CM4620 in MDA-MB-231. Cells were cultured without or with pretreatment with CM4620 (10 μM) and analyzed for repair as in . Scale bar, 200 µm. Data represents mean +/- SEM of three experiments, two-way ANOVA, **,p<0.01. The J panel shows the impairment of SLO-induced membrane damage in MDA-MB-231. Left panel shows representative FACS analysis of membrane repair in cells without or with CM4620 treatment. Right panel shows quantification of cells that failed to repair (PI staining) from 3 independent experiments. Data represents mean +/-SEM of three experiments. Welch’s t test, ***, p<0.001.

Article Snippet: All-in-One sgRNA CRISPR/Cas9 Lentivectors from Applied Biological Materials (Richmond, BC, Canada) were used to derive Orai1 (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro, #35720125) KO cell lines.

Techniques: Western Blot, Expressing, CRISPR, Clone Assay, Fluorescence, Clinical Proteomics, Membrane, Staining, Cell Culture, Inhibition

Journal: Cell Death & Disease

Article Title: Transglutaminase 2 exacerbates ovarian cancer survival by directly inactivating GSK3β

doi: 10.1038/s41419-026-08447-0

Figure Lengend Snippet: A Quantification of histological (H) scores for transglutaminase 2 (TGase 2) in normal ovarian tissue ( n = 27) and primary ovarian tumors ( n = 180) using inForm™ image‑analysis software. Scale bar, 100 µm. B Quantitative data for TGase 2 staining on tissue microarrays from normal controls ( n = 27) and tumors classified as stage I ( n = 83), stage II ( n = 24), stage III–IV ( n = 37), or metastatic lesions ( n = 36). Representative immunohistochemical (IHC) images are shown Supplementary Fig. . Scale bar, 100 µm. C Correlation analysis between TGM2 and epithelial-to-mesenchymal transition (EMT)–related genes grouped by biological function. The graphs of TMA analysis are presented as mean ± standard error of the mean (SEM). More information on this cohort is provided in Supplementary Fig. . Comparisons between two groups were performed using the Mann–Whitney test, while one-way analysis of variance (ANOVA) was used for comparisons among three or more groups. Statistical significance was defined as * p < 0.05, ** p < 0.01, **** p < 0.0001.

Article Snippet: The scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (#K010) and TGM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (#K2366205) for human cells were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada).

Techniques: Software, Staining, Immunohistochemical staining, MANN-WHITNEY

Journal: Cell Death & Disease

Article Title: Transglutaminase 2 exacerbates ovarian cancer survival by directly inactivating GSK3β

doi: 10.1038/s41419-026-08447-0

Figure Lengend Snippet: A TGase 2 modulates ovarian cancer cell migration. OVCAR‑5, OVCAR‑8, and SKOV‑3 cells were transfected for 48 h with TGM2 siRNA (20 or 40 nM), after which their migratory capacity was measured. Simultaneously, OVCAR‑3, OVCAR‑4, and SKOV‑3 cells were transfected with TGM2 expression plasmids (2 or 4 µg) for 48 h and tested in the same assay. RFUs indicate relative fluorescence units. B Effect of TGase 2 on epithelial-to-mesenchymal transition (EMT) markers. OVCAR‑8 cells transfected with TGM2 siRNA (40 nM) and SKOV‑3 cells transfected with TGM2 plasmid (4 µg, each for 48 h) were analyzed by immunoblotting for EMT-associated proteins. C WNT/β‑catenin signaling in ovarian cancer cells. OVCAR‑8 and SKOV‑3 cells were treated with lithium chloride (LiCl; 30 mM, 8 h) to inhibit GSK3β and activate the β‑catenin pathway. D TGase 2–GSK3β interaction detected by co‑immunoprecipitation. OVCAR‑8 cells transfected with TGM2 siRNA (40 nM) for 48 h were lysed under serum‑supplemented or serum‑starved conditions before co‑immunoprecipitation. E TGase 2 regulates GSK3β turnover through autophagy. OVCAR‑8 cells transfected with TGM2 siRNA (40 nM) for 48 h were starved and then treated with chloroquine (CQ; 50 µM, 6 h) or left untreated, followed by immunoblot analysis. All graphs are displayed as mean ± standard deviation (SD). All experiments were performed with three samples per group ( n = 3). Comparisons between two groups were performed using the Student’s t test, whereas comparisons among three or more groups were conducted using one-way analysis of variance (ANOVA). Statistical significance was defined as * p < 0.05 or ** p < 0.01 or *** p < 0.001, and ns indicates not significant.

Article Snippet: The scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (#K010) and TGM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (#K2366205) for human cells were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada).

Techniques: Migration, Transfection, Expressing, Fluorescence, Plasmid Preparation, Western Blot, Standard Deviation

Journal: Cell Death & Disease

Article Title: Transglutaminase 2 exacerbates ovarian cancer survival by directly inactivating GSK3β

doi: 10.1038/s41419-026-08447-0

Figure Lengend Snippet: A N-terminal region of TGase 2 is required for its interaction with GSK3β. HEK-293 cells were co-transfected with plasmids encoding FLAG-GSK3β and either wild-type TGM2 or the indicated TGM2 deletion mutants (Δ2-139, Δ147-460, Δ472-583, Δ592-673). Complexes were immunoprecipitated using an anti-FLAG antibody and analyzed by immunoblotting. B TGase 2 binds the catalytic core of GSK3β. HEK-293 cells were transfected with plasmids encoding FLAG-TGM2 and either wild-type GSK3β or point-mutated variants (Y216F, V267G/E268R, or F291L). Protein complexes were purified via anti-FLAG immunoprecipitation and examined by immunoblot analysis. C In silico docking predicts a direct interaction between TGase 2 and GSK3β. ClusPro docking of GSK3β (PDB 4NM5, gray) with TGase 2 (PDB 2Q3Z, pink) is shown as cartoons; interface residues are displayed as sticks (GSK3β, gray; TGase 2, blue-green and yellow). D TGase 2 inhibits the kinase activity of GSK3β in a dose-dependent manner. Recombinant GSK3β (2 ng) was incubated with increasing amounts of rhTGase 2 (0–8 ng), and kinase activity was quantified. The graphs display mean ± standard deviation (SD). Assays were performed with three samples per group ( n = 3). rhTGase 2; recombinant human TGase 2. E The TGase 2:GSK3β ratio modulates competing protein-protein interactions. Elevated TGase 2 expression strengthens the TGase 2–GSK3β interaction while reducing the association between GSK3β and β‑catenin. F Domain organization of GSK3β and TGase 2. Schematic diagrams depict the primary structures and domains of each protein, with residue ranges corresponding to the constructs analyzed in this study. BD: substrate binding domain.

Article Snippet: The scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (#K010) and TGM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (#K2366205) for human cells were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada).

Techniques: Transfection, Immunoprecipitation, Western Blot, Purification, In Silico, Activity Assay, Recombinant, Incubation, Standard Deviation, Protein-Protein interactions, Expressing, Residue, Construct, Binding Assay

Journal: Cell Death & Disease

Article Title: Transglutaminase 2 exacerbates ovarian cancer survival by directly inactivating GSK3β

doi: 10.1038/s41419-026-08447-0

Figure Lengend Snippet: A Generation of TGM2 knock-out cell lines using the CRISPR system. TGase 2 expression was confirmed by immunoblotting, and clone #2, which showed the lowest TGase 2 level, was selected for in vivo studies. To mimic ovarian cancer growth and metastasis, we evaluated antitumor efficacy using an intraperitoneal orthotopic model. Loss of TGase 2 decreases intraperitoneal (i.p.) tumor growth in an OVCAR‑8/Luc xenograft model. BALB/c‑nu/nu mice ( n = 12 per group) were inoculated i.p. (intraperitoneally) with 1 ×10 7 parental OVCAR‑8/Luc cells or OVCAR‑8/Luc cells with TGM2 KO. Tumor burden was monitored weekly via in vivo bioluminescence imaging (IVIS) and measured as total photon flux using Living Image software. Graphs show mean ± standard deviation (SD). Comparisons between groups used a Two-way ANOVA. Statistical significance was set at *** p < 0.001. ROI, region of interest. B Kaplan–Meier survival curves for the cohorts in ( A ). Deletion of TGM2 significantly improved overall survival (** p < 0.01, log‑rank test). To examine if TGase 2 also plays a role in late metastatic stages, we used a tail-vein lung metastasis model. TGase 2 promotes experimental ovarian cancer metastasis. Parental or TGM2 ‑KO OVCAR‑8/Luc cells were injected into the tail vein of BALB/c‑nude mice ( n = 4 per group). C Metastatic lesions collected at the endpoint were analyzed through immunohistochemistry. Scale bar, 100 μm (yellow) and 2 mm (black). D Quantification of metastatic burden and nodules. * p < 0.05, ** p < 0.01. E , F Immunohistochemical analysis of GSK3β expression in TG2-deficient tumors was performed using the Vectra Polaris™ Automated Quantitative Pathology Imaging System and inForm software (Akoya Biosciences, Waltham, MA, USA). Scale bar, 100 μm. Bar graphs display the number of metastatic nodules and the total tumor area per mouse (mean ± SD; n = 4). ** p < 0.01.

Article Snippet: The scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (#K010) and TGM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (#K2366205) for human cells were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada).

Techniques: Knock-Out, CRISPR, Expressing, Western Blot, In Vivo, Imaging, Software, Standard Deviation, Injection, Immunohistochemistry, Immunohistochemical staining

Journal: Cell Death & Disease

Article Title: Transglutaminase 2 exacerbates ovarian cancer survival by directly inactivating GSK3β

doi: 10.1038/s41419-026-08447-0

Figure Lengend Snippet: A Streptonigrin (STN) disrupts the TGase2–GSK3β interaction. HEK-293 cells were co‑transfected with FLAG- TGM2 and GSK3β -HA plasmids, cultured for 48 h, and then treated with the indicated concentrations of STN for 1 h. B STN reduces intracellular co‑localization of TGase 2 and GSK3β. OVCAR‑8 cells were exposed to 500 nM STN for 1 h and analyzed by confocal microscopy. Scale bar, 20 µm. C To assess whether TGase 2 inhibition suppresses metastasis, we utilized a tail-vein lung metastasis model. TGase2 inhibition decreases metastatic burden in a tail‑vein ovarian cancer model. SKOV‑3 cells were injected into the tail vein of BALB/c‑nude mice ( n = 4 per group). Metastatic lesions were collected and analyzed via immunohistochemistry. Scale bar, 100 µm. Bar graphs represent the number of metastatic nodules and total tumor area (mean ± SD; n = 4). Scale bar, 200 µm. D To confirm whether the same effect is observed in an authentic ovarian cancer metastasis model, we revalidated it using an orthotopic model. TGase2 inhibition delays tumor growth in an intraperitoneal xenograft model. OVCAR‑8/Luc cells (1 × 10⁷) were injected intraperitoneally into mice ( n = 9 per group). Beginning two days before cell inoculation, mice received oral PBS or STN (0.01 or 0.1 mg/kg) five days per week. Tumor growth was monitored weekly by bioluminescence imaging (IVIS) and total photon flux was plotted (mean ± SEM). E Kaplan–Meier survival curves for the mice in Fig. over 80 days after cell injection. All graphs are presented as mean ± standard deviation (SD). Multiple comparisons among three or more groups were performed using one-way analysis of variance (ANOVA). Statistical significance was considered at * p < 0.05, ** p < 0.01, and *** p < 0.001.

Article Snippet: The scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (#K010) and TGM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (#K2366205) for human cells were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada).

Techniques: Cell Culture, Confocal Microscopy, Inhibition, Injection, Immunohistochemistry, Imaging, Standard Deviation

Journal: Cell Death & Disease

Article Title: Transglutaminase 2 exacerbates ovarian cancer survival by directly inactivating GSK3β

doi: 10.1038/s41419-026-08447-0

Figure Lengend Snippet: A Conventional chemotherapies increase TGase 2 levels and decrease GSK3β levels. OVCAR‑3 or SKOV‑3 cells were treated with cisplatin (DDP, 1 mM) or paclitaxel (PTX, 10 μM) for 24 h, after which TGase 2 and GSK3β protein levels were measured by immunoblotting. B Chemotherapy treatment enhances the migratory ability of ovarian cancer cells. Cell migration was quantified after treatment with DDP or PTX in OVCAR-3 and SKOV-3 cells. The graphs show mean ± standard deviation (SD). Assays used three samples per group ( n = 3). C To assess metastasis suppression and the anti-tumor effects of first-line ovarian cancer therapy combined with a TGase 2 inhibitor, we performed tests using an orthotopic model using OVCAR‑8/Luc cells. Pharmacological inhibition of TGase 2 works synergistically with conventional chemotherapies and prolongs survival in an ovarian cancer mouse model. Mice ( n ≥ 8 per group) received phosphate-buffered saline (PBS), streptonigrin (STN; 0.01 mg/kg), DDP (1 mg/kg), PTX (1 mg/kg), STN + DDP, or STN + PTX. Kaplan–Meier survival curves are shown; median survival was calculated using Kaplan–Meier statistics. D Quantification of histological scores for GSK3β in ovarian cancer patient tissue using inForm™ image analysis software. Tumors were classified as stage I ( n = 83), stage II ( n = 24), stage III–IV ( n = 37), or metastatic lesions ( n = 36). Representative immunohistochemical (IHC) images are included (Supplementary Fig. ) scale bar, 100 µm. E Comparison of TG2 and GSK3β expression patterns during tumor development and metastasis. The TMA analysis graphs are presented as mean ± standard error of the mean (SEM). Multiple comparisons among three or more groups were performed with one-way analysis of variance (ANOVA). Statistical significance was set at ** p < 0.01, *** p < 0.001, and **** p < 0.0001. ns, not significant.

Article Snippet: The scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (#K010) and TGM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (#K2366205) for human cells were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada).

Techniques: Western Blot, Migration, Standard Deviation, Inhibition, Saline, Software, Immunohistochemical staining, Comparison, Expressing

Journal: eBioMedicine

Article Title: Generation and characterisation of a humanised GLP-1 receptor mouse model for translational drug development

doi: 10.1016/j.ebiom.2026.106121

Figure Lengend Snippet: The humanised GLP-1 receptor mouse expresses only the human GLP1R receptor. (A) The humanised GLP1R mouse model was generated on a C57BL/6N background using CRISPR-Cas9 technology, replacing the endogenous murine GLP-1 receptor (mGLP1R) with the human receptor (hGLP1R) starting from position G27 (exon 2). Pink/turquoise codons in human/mouse Glp1r allele illustrates species differences, dark blue illustrates identical codons. Codon coding for tryptophan/serine in human/mouse at position 33 is highlighted due to its essentiality in facilitating small-molecule GLP1RA binding. Anti-mouse and anti-human GLP1R antibodies were used to compare GLP1R expression in the (B) pancreas, (C) hypothalamus and (D) brain stem of littermate wild-type (WT) and hGLP1R mice. Arrows in panel B indicate pancreatic islet of β-cells. Insert: Magnified image of small dotted framed area (20× magnification). AP, area postrema; ARH, arcuate hypothalamic nucleus; GLP1R, glucagon-like peptide-1 receptor; NTS nucleus of the solitary tract.

Article Snippet: Briefly, purified Cas-9 nuclease (100 ng/μL, #10000735, Integrated DNA Technologies, Coralville, IA), CRISPR-Cas9 sgRNA CGTCTCTGAGAGGGACACCG (50 ng/μL, Synthego, Redwood City, CA) and a plasmid donor for homology-directed repair (10 ng/μL), were microinjected into fertilised C57BL/6N zygotes and implanted into pseudopregnant females.

Techniques: Generated, CRISPR, Binding Assay, Expressing

Journal: Nature

Article Title: The ubiquitin ligase KLHL6 drives resistance to CD8 + T cell dysfunction

doi: 10.1038/s41586-025-09926-8

Figure Lengend Snippet: a , Sanger sequencing of the Klhl6 locus in Cas9 + sgRNA + OT-I T cells transduced with sgCtrl , sgKlhl6 -1, or sgKlhl6 -2 in vitro. Primer sequences are listed in Supplementary Table . b , c , Mice were subcutaneously injected with 2×10 5 B16-OVA melanoma cells, followed by transfer of 3×10 Cas9 + CD8 + OT-I T cells expressing control sgRNA or sgKlhl6 (two targets) on day 9. Tumours were collected and analyzed 7 days later. Experimental design ( b ). The number of transferred Cas9 + OT-I T cells in the tumour ( c , n = 7 mice). d , e , Representative plots (left) and proportions (right) of LAG-3 + TIM-3 + TILs ( d ), and cell numbers of indicated subsets ( e ) among sgCtrl - or sgKlhl6 -transduced Cas9 + CD8 + OT-I TILs (n = 7 mice). f , g , Proportions of PD-1 + TIM-3 + ( f ) and (MTDR/MTG) lo ( g ) TILs among sgCtrl- or the indicated sgRNA- transduced Cas9 + CD8 + OT-I T cells from B16-OVA tumours (n = 6 mice). h , Schematic of CRISPR/Cas9-mediated generation of Klhl6 −/− mice. Guide RNA sequences are provided in Supplementary Table . i , Genotyping results for Klhl6 +/+ (WT) or Klhl6 −/− (KO) alleles. j , k , Percentages of thymocyte subsets: CD4 − CD8 − double-negative (DN), CD4 + CD8 + double-positive (DP), CD4 + single-positive (CD4SP) and CD8 + single-positive (CD8SP) ( j ), and CD44 + single-positive (DN1), CD44 + CD25 + double-positive (DN2), CD25 + single-positive (DN3) and CD44 − CD25 − double-negative (DN4) subpopulations ( k ) in DN cells of WT and KO mice (n = 6 mice). l , Numbers of CD19 + , CD4 + , and CD8 + cells in spleens of WT and KO mice (n = 6 mice). m , Percentages of naïve (CD44 lo CD62L hi ), central memory (CD44 hi CD62L hi ; CM) and effector/effector memory (CD44 hi CD62L lo , EFF/EM) CD8 + and CD4 + T cells in spleens of WT and KO mice (n = 6 mice). n , o , Proliferation of naïve WT and KO CD8 + T cells following anti-CD3/CD28 activation measured by CFSE dilution ( n ), and expression of activation markers (CD44, CD69 and CD25) at days 1-2 in vitro ( o ). p , Experimental design related to Fig. . q - s , Percentages of transferred CD45.1/2 + OT-I T cells in dLN and spleen ( q ), and quantification of PD-1, TIM-3, LAG-3, and TOX expression OT-I TILs ( r , s ) at day 14 post-ACT (n = 14 mice). t , Survival curves of tumour-bearing mice after transfer of 5×10 CD45.1/2 + WT and KO OT-I T cells (n = 13 mice). Mice with tumour volumes >1500 mm 3 were euthanized and defined as death. Diagram in b created in BioRender. Li, G. (2025) https://BioRender.com/aicmpdn . Diagram in p created in BioRender. Li, G. (2025) https://BioRender.com/0feebot . Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( q - s ), two-way ANOVA with Tukey’s multiple-comparisons test ( c - g ), two-way ANOVA with Sidak’s multiple-comparisons test ( j - m ), and Log-rank (Mantel-Cox) test ( t ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

Article Snippet: In this study, CRISPR–Cas9 sgRNA was expressed using pSL21-Thy1.1 or pSL21-mCherry (Addgene, 164410) . sgRNAs were generated by annealing two DNA oligos and then ligated into the pSL21-Thy1.1 or pSL21-mCherry vector after digestion with BbsI.

Techniques: Sequencing, Transduction, In Vitro, Injection, Expressing, Control, CRISPR, Activation Assay, Two Tailed Test